reconstitution comes up often in conversation and rarely with the context attached. Here we lay out the basics in order, then work through the practical considerations.
Last reviewed on 2026-01-23. Where a claim depends on a specific study, the study is described rather than over-claimed.
Temperature logs and cold-chain documentation help identify excursions that may compromise a batch. Automated freezers, desiccant packs, and sealed containers limit moisture and frost accumulation. Aliquoting small portions before freezing reduces the number of times the main stock changes temperature. Labels should include peptide name, lot, concentration if known, solvent, and date prepared. Periodic analytical verification by high-performance liquid chromatography or mass spectrometry can detect degradation, truncation, or sequence errors that visual inspection cannot reveal.
Practical handling begins with an inventory record that links each vial to a lot number, synthesis date, and purity certificate. Before opening a container, allow it to equilibrate to room temperature to prevent condensation on the powder. Weighing or transferring should occur in a low-humidity environment using tools that minimize static and adsorption. Hygroscopic peptides may gain water quickly, changing mass and concentration estimates. Recording the container's initial mass and any visible changes supports later reconciliation of material.
Reconstitution introduces additional variables: solvent choice, pH, ionic strength, and filtration. Many sequences dissolve readily in water, while hydrophobic ones may need acetonitrile, dimethyl sulfoxide, or a small amount of base. Adding solvent slowly and avoiding vigorous vortexing can reduce foaming and shear-induced aggregation. If the solution appears cloudy, filtration may remove particulates but can also remove aggregated peptide and alter concentration. A clear solution does not by itself confirm correct sequence or purity, so analytical checks remain necessary.
Reconstitution introduces new risks because the peptide contacts solvent, air, and container surfaces. The chosen solvent should match the peptide's solubility profile, and buffer salts, pH, and ionic strength can affect dissolution and subsequent stability. Gentle mixing is preferred over vigorous vortexing, which can create interfaces and shear. If the solution is not clear, the cause may be incomplete dissolution, aggregation, or insoluble counter-ions rather than a simple concentration problem. Filtration is sometimes used, but filters can adsorb peptides and alter measured concentration.
Cold-chain practice relies on documented temperature ranges, calibrated monitoring, and minimized excursions. Shipments may use insulated boxes, phase-change materials, or dry ice, with data loggers to record conditions. Upon receipt, the recipient should verify the logger trace and place items into long-term storage promptly. Repeated warming and cooling during transfers can be more harmful than a single controlled excursion. For solutions, dividing material into single-use aliquots reduces the number of thawing and refreezing events and limits repeated opening of the same container.
| Property | Value | Notes |
|---|---|---|
| Container material | Glass or polypropylene | Glass is relatively inert but can adsorb; polypropylene may leach. |
| Headspace gas | Argon or nitrogen | Inert gas displaces oxygen for oxidation-prone sequences. |
| Equilibration before opening | 20–30 minutes at room temperature | Sealed vial warms gradually to reduce condensation. |
| Typical aliquot size | Small working portions | Limits repeated temperature cycling of the main stock. |
| Documentation fields | Lot, date, solvent, concentration | Supports traceability and degradation monitoring. |
The following table is based on the ISSCAAP classification (International Standard Statistical Classification of Aquatic Animals and Plants) used by the FAO to collect and compile fishery statistics. The production figures have been extracted from the FAO FishStat database, and include both capture from wild fisheries and aquaculture production.
== As an oncolytic agent == Sendai virus-based anticancer therapy for model and companion animals has been reported in several scientific papers. The described studies demonstrate that Sendai virus has a potential of becoming a safe and effective therapeutic agent against a wide range of human cancers. High genomic stability of SeV is a very desirable trait for oncolytic viruses. SeV is not likely to evolve into a pathogenic strain or into a virus with decreased oncolytic potential. The cytoplasmic replication of the virus results in a lack of host genome integration and recombination, which makes SeV safer and more attractive candidate for broadly used therapeutic oncolysis compared to some DNA viruses or retroviruses.
Antimicrobial treatment of bloodstream infections is initially empiric, meaning it is based on the clinician's suspicion about the causative agent of the disease and local patterns of antimicrobial resistance. Carrying out antibiotic susceptibility testing (AST) on pathogens isolated from a blood culture allows clinicians to provide a more targeted treatment and to discontinue broad-spectrum antibiotics, which can have undesirable side effects. In traditional AST methods, such as the disk diffusion test, pure colonies of the organism are selected from the subculture plate and used to inoculate a secondary medium. These methods require overnight incubation before results can be obtained. There are automated systems which use pre-formulated antibiotic panels, measure microbial growth automatically, and determine the sensitivity results using algorithms; some of these can provide results in as little as five hours, but others require overnight incubation as well. Rapid administration of effective antimicrobial drugs is crucial in the treatment of sepsis, so several methods have been developed to provide faster antibiotic sensitivity results. Conventional AST methods can be carried out on young growth from the subculture plate, pellets of microorganisms obtained from concentration and purification of the positive blood culture, or directly from the culture bottle. Because direct testing methods do not isolate the organisms, they do not provide accurate results if more than one microorganism is present, although this is an infrequent occurrence in blood cultures.
Unlike other ribosomal peptide natural products, which are normally synthesized with a leader peptide that is cleaved, bottromycin is synthesized with a follower peptide. The presence of a follower peptide was identified by bioinformatic analysis of the bottromycin biosynthetic cluster.
Sources: en.wikipedia.org
The nephrotic syndrome is characterised by the finding of edema in a person with increased protein in the urine and decreased protein in the blood, with increased fat in the blood. Inflammation that affects the cells surrounding the glomerulus, podocytes, increases the permeability to proteins, resulting in an increase in excreted proteins. When the amount of proteins excreted in the urine exceeds the liver's ability to compensate, fewer proteins are detected in the blood – in particular albumin, which makes up the majority of circulating proteins. With decreased proteins in the blood, there is a decrease in the oncotic pressure of the blood. This results in edema, as the oncotic pressure in tissue remains the same. Although decreased intravascular oncotic (i.e. osmotic) pressure partially explains the patient's edema, more recent studies have shown that extensive sodium retention in the distal nephron (collecting duct) is the predominant cause of water retention and edema in the nephrotic syndrome. This is worsened by the secretion of the hormone aldosterone by the adrenal gland, which is secreted in response to the decrease in circulating blood and causes sodium and water retention. Hyperlipidemia is thought to be a result of the increased activity of the liver.
CmCl3 + 3 NH4I → CmI3 + 3 NH4Cl Or, one can heat curium oxide to ~600 °C with the corresponding acid (such as hydrobromic for curium bromide). Vapor phase hydrolysis of curium(III) chloride gives curium oxychloride:
=== United States === In the United States, biologics are licensed through the biologics license application (BLA), then submitted to and regulated by the FDA's Center for Biologics Evaluation and Research (CBER) whereas drugs are regulated by the Center for Drug Evaluation and Research. Approval may require several years of clinical trials, including trials with human volunteers. Even after the drug is released, it will still be monitored for performance and safety risks. The manufacture process must satisfy the FDA's "Good Manufacturing Practices", which are typically manufactured in a cleanroom environment with strict limits on the amount of airborne particles and other microbial contaminants that may alter the efficacy of the drug.
Sources: en.wikipedia.org
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
Ractopamine () is an animal feed additive used to promote leanness and increase food conversion efficiency in farmed animals in few countries, banned in most. Pharmacologically, it is a phenol-based TAAR1 agonist and β adrenoreceptor agonist that stimulates β1 and β2 adrenergic receptors. It is most commonly administered to animals for meat production as ractopamine hydrochloride. It is the active ingredient in products marketed in the US as Paylean for swine, Optaflexx for cattle, and Topmax for turkeys. It was developed by Elanco Animal Health, a former division of Eli Lilly and Company. As of 2025, the use of ractopamine "is banned or its use restricted in 168 nations", including the European Union, China and Russia, while it is legal in some other countries, with differing maximum residual limits (MRLs) in meat. Examples include the United States (50 ppb in pork, 30 ppb in beef); Japan, Taiwan and South Korea (10 ppb, in accordance with the Codex Alimentarius Commission); and New Zealand (0.1 ppb). Commercial ractopamine is a mixture of all four possible stereoisomers. It is also a positional isomer of dobutamine, a related drug.
=== 3 June === A missile strike on Dnipro killed a two-year-old girl and wounded 22 people after it hit a two-story building. Five of them were reportedly children, seventeen people were hospitalized and several were believed to have been trapped under the rubble. Belgorod Oblast Governor Vyacheslav Gladkov said that two people were killed by Ukrainian shelling.
== Professional activities == After earning a Ph.D. degree in biochemistry, a medical degree, and completing a research postdoctoral fellowship at the University of Wisconsin–Madison, Holick completed a residency in medicine at the Massachusetts General Hospital in Boston. He has been practicing adult and pediatric endocrinology since 1978 and is professor of medicine, physiology and biophysics and director of the Bone Health Care Clinic and the Heliotherapy, Light, and Skin Research Center at Boston University Medical Center. It provides extensive evaluation and treatment programs for children and adults with various metabolic bone diseases including osteoporosis, osteomalacia, stress fractures in young athletic women and men, and minimum trauma and nontraumatic fractures in infants, children and adults with hypermobility syndromes, osteogenesis imperfecta, and Ehlers–Danlos syndrome. He has been director of the General Clinical Research Unit at Boston University for several years. Holick serves as chair of NASA's "Human Health Countermeasures Element" Standing Review Panel, chair of the Endocrine Practice Guidelines Committee for Vitamin D, and editor-in-chief of the medical journal Clinical Laboratory.
Sources: en.wikipedia.org
Work quickly in a dry environment and keep the container closed when not in use. Equilibrate sealed vials to room temperature before opening to reduce condensation. Record mass changes, as absorbed water can affect concentration calculations.
Liquid storage is generally shorter than dry storage because water enables hydrolysis, oxidation, and microbial growth. If solution storage is necessary, use sterile technique, appropriate pH, and cold temperatures. Aliquot to avoid repeated temperature changes.
Reversed-phase high-performance liquid chromatography is common for purity assessment, while mass spectrometry confirms molecular mass and can reveal modifications. Amino acid analysis or sequencing may be used when sequence information is critical. These methods complement visual inspection and storage records.
Allow the sealed vial to reach room temperature before opening to reduce condensation. Use a suitable solvent and gentle mixing rather than vigorous agitation. Follow the supplier's solubility information when available.